View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19391_low_19 (Length: 233)
Name: NF19391_low_19
Description: NF19391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19391_low_19 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 28 - 233
Target Start/End: Original strand, 32868768 - 32868972
Alignment:
| Q |
28 |
aagaaaactaaagtcaatattcaacgccaaaatagaaagattagaaaaagtaaacactttaattagacggcaaatgtcatacttgctataatacaaagct |
127 |
Q |
| |
|
|||||||| || ||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
32868768 |
aagaaaaccaatgtcaatattcaacaccaaaatagaaagattagaaaaagtaaacactctaattagacgacaaatgtcatacttgctataatactaagct |
32868867 |
T |
 |
| Q |
128 |
tgcttttattattatctatagatttgcgagtttcaaattatagcaaaccttgtttatctgatgctgattttgtgttgtgattgtgaccattaccgcaaca |
227 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32868868 |
tgcttt-attattatctatagatttgcgagtttcaaattatagcaaaccttgtttatctgatgcttattttgtgttgtgattgtgaccattaccgcaaca |
32868966 |
T |
 |
| Q |
228 |
aggaca |
233 |
Q |
| |
|
|||||| |
|
|
| T |
32868967 |
aggaca |
32868972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 98 - 147
Target Start/End: Original strand, 7964517 - 7964565
Alignment:
| Q |
98 |
caaatgtcatacttgctataatacaaagcttgcttttattattatctata |
147 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||| |||||||||||||||| |
|
|
| T |
7964517 |
caaatgtcatacttgccataatactaagcttgc-tttattattatctata |
7964565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University