View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19393_high_4 (Length: 374)
Name: NF19393_high_4
Description: NF19393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19393_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 59 - 359
Target Start/End: Complemental strand, 36571827 - 36571527
Alignment:
| Q |
59 |
gactgggtgtggtttaaaagataagcatgtggaagcattggaggtatttagtgagatgatgagattcaatgtggtgcctaacgagtcttcttttactagt |
158 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36571827 |
gactgggtgtggtttaaatgataagcatgtggaagcattggaggtttttagtgagatgatgagattcaatgtggtgcctaacgagtcttcttttactagt |
36571728 |
T |
 |
| Q |
159 |
gctttgaattcttgtgttgggttggaggatcttgagaagggtagagtgattcatgctgcaggaattaaaatgggtttggaaaatgcagtctatacgggga |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36571727 |
gctttgaattcttgtgttgggttggaggatcttgagaagggtagagtgattcatgctgcaggaattaaaatgggtttggaaaatgcagtctatacgggga |
36571628 |
T |
 |
| Q |
259 |
attctcttgttgttatgtatagtaaatgtggttttattggtgatgcattgtgtgtgtttaaggggattggtgagaagaatgttgtgtcttggaattctgt |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36571627 |
attctcttgttgttatgtatagtaaatgtggttttattggtgatgcattgtgtgtgtttaaggggatttgtgagaagaatgttgtgtcttggaattctgt |
36571528 |
T |
 |
| Q |
359 |
g |
359 |
Q |
| |
|
| |
|
|
| T |
36571527 |
g |
36571527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University