View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19393_high_7 (Length: 213)
Name: NF19393_high_7
Description: NF19393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19393_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 35256635 - 35256437
Alignment:
| Q |
1 |
aactgaatctaccttttccctttgtttttcctttgaaccattgtccaacgtacatgcacccatccgtccatagatattttccttctccatgtggaaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35256635 |
aactgaatctaccttttccctttgtttttcctttgaaccattgtccaacgtacatgcacccatccgtccatagatattttccttctccatgtggaaaatt |
35256536 |
T |
 |
| Q |
101 |
ttctgcccattgtcctgtatagtaatcaccattggaaagaaccttctcttcggtgtatagttcaaatacctggtttccattttcatcgttatcatcatg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35256535 |
ttctgcccattgtcctgtatagtaatcaccattggaaagaaccttctcttcggtgtatagttcaaatacctggtttccattttcatcgttatcatcatg |
35256437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 15 - 149
Target Start/End: Original strand, 19643115 - 19643249
Alignment:
| Q |
15 |
tttccctttgtttttcctttgaaccattgtccaacgtacatgcacccatccgtccatagatattttccttctccatgtggaaaattttctgcccattgtc |
114 |
Q |
| |
|
|||||| | ||||||||||||||||||| |||||| || || || ||||| ||||||| || || |||| |||||||| || || || ||||||| || |
|
|
| T |
19643115 |
tttcccatagtttttcctttgaaccattctccaacatatatacatccatctgtccataagtacttccctttcccatgtgggaagttatcagcccattctc |
19643214 |
T |
 |
| Q |
115 |
ctgtatagtaatcaccattggaaagaaccttctct |
149 |
Q |
| |
|
|| |||||||||| ||||||| |||||| ||||| |
|
|
| T |
19643215 |
ctttatagtaatctccattgggtagaaccctctct |
19643249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University