View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19393_low_9 (Length: 219)
Name: NF19393_low_9
Description: NF19393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19393_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 12 - 199
Target Start/End: Original strand, 47881277 - 47881464
Alignment:
| Q |
12 |
cgaagaatatttatataaaccctaattatttctttgaaggatataaaccctagctcatagacgtgacaaaagttgaacaatctgctccatttcattgtca |
111 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47881277 |
cgaaaaatatttatataaaccctaattttttctttgaaggatataaaccctagctcatagacgtgacaaaagttgaacaatctgctccatttcattgtca |
47881376 |
T |
 |
| Q |
112 |
attccgagagccttaaaatccctcataactttcaaaaattcatcataattctccctctcatcatcatcaacgtttgtactgatttcat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47881377 |
attccgagagccttaaaatccctcataactttcaaaaattcatcataattctccctctcatcatcatcaacgtttgtactgatttcat |
47881464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University