View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19394_high_6 (Length: 219)
Name: NF19394_high_6
Description: NF19394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19394_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 18 - 211
Target Start/End: Complemental strand, 9452812 - 9452619
Alignment:
| Q |
18 |
ttacattcaacatagcatctcaccatgcacctgcaatcagtaaacatgattcccttagttttggtgggaactctacatgcaaggcttatgcaacagcccc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
9452812 |
ttacattcaacatagcatctcaccatgcacctgcaatcagtaaacatgattcccttagttttggtgggaactctacatgcaatgcttatgcaacggcccc |
9452713 |
T |
 |
| Q |
118 |
taatttctcgtcgtggaattgcatgaaatgtttgcatgaagactgtgccttttgtgctaatacccagagtgaagtaagttctactatattcttc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9452712 |
taatttctcgtcgtggaattgcatgaaatgtttgcatgaagactgtgccttttgtgctaatacccaaagtgaagtaagttctactatattcttc |
9452619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 9441581 - 9441401
Alignment:
| Q |
18 |
ttacattcaacatagcatctcaccatgcacctgcaatcagtaaacatgattcccttagttttggtgggaactctacatgcaaggcttatgcaacagcccc |
117 |
Q |
| |
|
||||||||||| ||| |||||||||||||| || |||||| ||| ||||| ||||| |||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
9441581 |
ttacattcaaccaggcagctcaccatgcaccttcactcagtatacaagattcacttagctttggtgggaactctacatgcaaggcttatacaacggcccc |
9441482 |
T |
 |
| Q |
118 |
taatttctcgtcgtggaattgcatgaaatgtttgcatgaagactgtgccttttgtgctaatacccagagtgaagtaagttc |
198 |
Q |
| |
|
||| || |||||||||||| ||| |||||||||||||||| ||||| |||||||| |||| ||||| |||||||||||| |
|
|
| T |
9441481 |
aaatcacttgtcgtggaattgtatgcaatgtttgcatgaagattgtgcattttgtgccaatagccagaatgaagtaagttc |
9441401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University