View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19394_high_9 (Length: 206)
Name: NF19394_high_9
Description: NF19394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19394_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 187
Target Start/End: Complemental strand, 30100027 - 30099855
Alignment:
| Q |
15 |
cagagacatgaggacaagacatggatgttcctgacatgaaattgtagtcacttgataagaacacatttgtgccaattctagctgttggcttgttaggaat |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30100027 |
cagaaacatgaggacaagacatggatgttcctgacatgaaattgtagtcacttgataagaacacatttgtgccaattctagctgttggtttgttaggaat |
30099928 |
T |
 |
| Q |
115 |
ataagctgcaagaactcttgatccaggtgccattatatcaggtttcaaaatccatggatagctatgtgaagga |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30099927 |
ataagctgcaagaactcttgatccaggtgccattatatcaggtttcaaaatccatggatagctatgtgaagga |
30099855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 15 - 183
Target Start/End: Original strand, 30090889 - 30091057
Alignment:
| Q |
15 |
cagagacatgaggacaagacatggatgttcctgacatgaaattgtagtcacttgataagaacacatttgtgccaattctagctgttggcttgttaggaat |
114 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| || | ||||| |
|
|
| T |
30090889 |
cagaggcatgaggacaagccatggatgttcctgacatgaaattgtagtcacttgataagaacacatcggtaccaattctagctgttggtttataaggaac |
30090988 |
T |
 |
| Q |
115 |
ataagctgcaagaactcttgatccaggtgccattatatcaggtttcaaaatccatggatagctatgtga |
183 |
Q |
| |
|
| |||| || |||||||||||||||||||||||||| ||||| ||||||||||| ||| ||| |||||| |
|
|
| T |
30090989 |
aaaagcagcgagaactcttgatccaggtgccattatgtcaggcttcaaaatccaaggaaagccatgtga |
30091057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University