View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19395_high_12 (Length: 318)
Name: NF19395_high_12
Description: NF19395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19395_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 3 - 209
Target Start/End: Complemental strand, 18721502 - 18721296
Alignment:
| Q |
3 |
gttacttaccgggatcaagtgaaagttgagaaagattgtattcagatgaaggagaagtgttgagtttgcatggaagtttgtgcaaatgggttttgagatt |
102 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18721502 |
gttacttaccaggatcaagtgaaagttgagaaagattgtattcagatgaaggagaagtattgagtttgcatggaagtttgtgcaaatgggttttgagatt |
18721403 |
T |
|
| Q |
103 |
ttgagggaaagatggaatgaaaggtagttgttgaagtgaaggtaaaggaagaagagcagggtaatatctttgatacttgttttggtagtagttgttgtag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18721402 |
ttgagggaaagatggaatgaaaggtagttgttgaagtgaaggtaaaggaagaagagcagggtaatatctttgatacttgttttggtagtagttgttgtag |
18721303 |
T |
|
| Q |
203 |
aaaccaa |
209 |
Q |
| |
|
||||||| |
|
|
| T |
18721302 |
aaaccaa |
18721296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University