View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19395_low_2 (Length: 258)
Name: NF19395_low_2
Description: NF19395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19395_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 17 - 163
Target Start/End: Original strand, 28909530 - 28909676
Alignment:
| Q |
17 |
aacatcataccggattgatgcacggtatcctcttttaatgaattgaaaaagtctctggtgaatgtatcaacatgggatagaaactgctcaccgagctctt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
28909530 |
aacatcataccggattgatgcacggtatcctcttttaatgaattgaaaaagtctctggtgaatgtatcaacatgggatagcaactactcaccgagctctt |
28909629 |
T |
|
| Q |
117 |
tcttggcaggatcctagaaaaaatttacactaatagtcaattttatt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28909630 |
tcttggcaggatcctagaaaaaatttacactaatagtcaattttatt |
28909676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 173 - 258
Target Start/End: Original strand, 28909705 - 28909790
Alignment:
| Q |
173 |
ggggcacaacatgatggtgaggttaaggtttctgatgtgtttctgcttccacaatggcatcacaattcacaatagaccttagtctc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28909705 |
ggggcacaacatgatggtgaggttaaggtttctaatgtgtttctgattccacaatggcatcacaattcacaatagaccgtagtctc |
28909790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 73 - 128
Target Start/End: Original strand, 28914544 - 28914599
Alignment:
| Q |
73 |
ggtgaatgtatcaacatgggatagaaactgctcaccgagctctttcttggcaggat |
128 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
28914544 |
ggtgaatgtatcaacatgggataacaactgctcaccgaactctttcttggcaggat |
28914599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 72 - 149
Target Start/End: Original strand, 28922154 - 28922231
Alignment:
| Q |
72 |
tggtgaatgtatcaacatgggatagaaactgctcaccgagctctttcttggcaggatcctagaaaaaatttacactaa |
149 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||||| | | ||||||||||||||||||||| |||||| ||| ||||| |
|
|
| T |
28922154 |
tggtgaaggtatcaacatgtgataacaactgctcagcaaactctttcttggcaggatcctacaaaaaaattatactaa |
28922231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 67 - 131
Target Start/End: Original strand, 40288672 - 40288736
Alignment:
| Q |
67 |
gtctctggtgaatgtatcaacatgggatagaaactgctcaccgagctctttcttggcaggatcct |
131 |
Q |
| |
|
|||| ||||||||||||||||||| || | ||||| ||||| | ||||||||| |||||||||| |
|
|
| T |
40288672 |
gtctttggtgaatgtatcaacatgagaaatcaactgatcaccaaactctttctttgcaggatcct |
40288736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University