View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19396_low_3 (Length: 280)
Name: NF19396_low_3
Description: NF19396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19396_low_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 12 - 152
Target Start/End: Original strand, 53336615 - 53336755
Alignment:
| Q |
12 |
aatacttaaagcactgagttgcaaggatcataacagtgtcgccgtaacgacgacattttctttgcctcaaacatcatcttaatttagaaattggatgtct |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53336615 |
aatacttaaagcactgagttgcaaggatcataacagtgtcgccgtaacgacgacattttctttgcctcaaacatcatcttaatttagaaattggatgtct |
53336714 |
T |
|
| Q |
112 |
cggcaatttaccgcattcacaaagtcggaacatctttacta |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53336715 |
tggcaatttaccgcattcacaaagtcggaacatctttacta |
53336755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University