View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19396_low_5 (Length: 245)
Name: NF19396_low_5
Description: NF19396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19396_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 42677327 - 42677514
Alignment:
| Q |
1 |
tgttgccgatactatgcacaattatttgctttgtgaacacatatatactacatgttttcgtggtaccttcagaacatgttcacgccatgtttgtttttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42677327 |
tgttgccgatactatgcacaattatttgctttttgaacacatatatactacatgttttcgtggtaccttcagaacatgttcacgccatgtttgtttttta |
42677426 |
T |
|
| Q |
101 |
agtgtttgtaccgattctattatgaaccacgctagccatcaattgaaaaatattgtaaggggaggttaattcatacagctttgtctaa |
188 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42677427 |
agtgtttgtaccgattctattgtgaaccacgctagccatcaattgaaaaatattgtaaggggaggttaattcatacagctttgtctaa |
42677514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 205 - 238
Target Start/End: Original strand, 42677520 - 42677553
Alignment:
| Q |
205 |
atgtgacggtgagttttgtttgtggtgatgatgt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42677520 |
atgtgacggtgagttttgtttgtggtgatgatgt |
42677553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 48968882 - 48968805
Alignment:
| Q |
1 |
tgttgccgatactatgcacaattatttgctttgtgaacacatatatactacatgttttcgtggtaccttcagaacatgttca |
82 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||| ||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
48968882 |
tgttgctgatactatgcacaattatttgctttttgaacac----ctactacaggtttttgtggtaccttcagaacatgttca |
48968805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 205 - 238
Target Start/End: Complemental strand, 15496130 - 15496097
Alignment:
| Q |
205 |
atgtgacggtgagttttgtttgtggtgatgatgt |
238 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
15496130 |
atgtggcggtgagttttgtttgtggtgatgatgt |
15496097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 205 - 238
Target Start/End: Complemental strand, 6705752 - 6705719
Alignment:
| Q |
205 |
atgtgacggtgagttttgtttgtggtgatgatgt |
238 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
6705752 |
atgtggcggtgagttttgtttgtggtgatgatgt |
6705719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 205 - 238
Target Start/End: Complemental strand, 40900436 - 40900403
Alignment:
| Q |
205 |
atgtgacggtgagttttgtttgtggtgatgatgt |
238 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
40900436 |
atgtggcggtgagttttgtttgtggtgatgatgt |
40900403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 129 - 177
Target Start/End: Complemental strand, 40900512 - 40900464
Alignment:
| Q |
129 |
acgctagccatcaattgaaaaatattgtaaggggaggttaattcataca |
177 |
Q |
| |
|
||||||||||||||||| |||||||| || |||||||| ||||||||| |
|
|
| T |
40900512 |
acgctagccatcaattgggaaatattgcaaagggaggttcattcataca |
40900464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University