View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19397_low_4 (Length: 295)
Name: NF19397_low_4
Description: NF19397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19397_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 58 - 276
Target Start/End: Original strand, 2464924 - 2465136
Alignment:
| Q |
58 |
gttatgctgaagtggtatgaaactagggaagtccactacataccacgcccagactaagaataaacaaagattgtgaaaaagggcatttaacgatgtttga |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
2464924 |
gttatgctgaagtggtatgaaactagggaagtccaccacataccacgcccagactaagaataaacaaagactgtgaaaa-gggcatttaacgatgtttga |
2465022 |
T |
 |
| Q |
158 |
gatgttgtgtttataacagaagaaatcaatggagaaaatttttacactctagagtggcactaaaacactaccactcaaataaaggctgtcgccaggtctg |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2465023 |
gatgttgtgtttataacagaagaaatcaatggagaaattttttacactccagagtgccactaaa-----accactcaaataaaggctgtcgccaggtctg |
2465117 |
T |
 |
| Q |
258 |
gacacaactaacaagcttg |
276 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2465118 |
gacacaactaacaagcttg |
2465136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 50
Target Start/End: Original strand, 2463234 - 2463283
Alignment:
| Q |
1 |
cattggttcaaaaaatttataatgttggcctcaaatcttgaaccatacca |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2463234 |
cattggttcaaaaaatttataatgttggcctcaaatcttgaaccatacca |
2463283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University