View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19399_high_46 (Length: 207)
Name: NF19399_high_46
Description: NF19399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19399_high_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 6e-36; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 20 - 96
Target Start/End: Complemental strand, 5179244 - 5179168
Alignment:
| Q |
20 |
tgaggcatataattagagtagtgttttacctatatcacgtgaactattatttgaagtactaaaatttcacacattca |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5179244 |
tgaggcatataattagagtagtgttttacctatatcacgtgaactattatttgaagtactaaaatttcacacattca |
5179168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 139 - 196
Target Start/End: Complemental strand, 5179144 - 5179087
Alignment:
| Q |
139 |
ctcacattgcaagtgttttagttgcatagacttataaaggtaattcctatactatatt |
196 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||| | |||||||||| |
|
|
| T |
5179144 |
ctcacattgcaagtgtttgagttgcatagacttgtaaaggtaatttccatactatatt |
5179087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 146 - 182
Target Start/End: Original strand, 5058010 - 5058046
Alignment:
| Q |
146 |
tgcaagtgttttagttgcatagacttataaaggtaat |
182 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5058010 |
tgcaagtgtttgagttgcatagacttataaaggtaat |
5058046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University