View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19399_low_27 (Length: 294)
Name: NF19399_low_27
Description: NF19399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19399_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 187 - 279
Target Start/End: Original strand, 25507035 - 25507127
Alignment:
| Q |
187 |
agcagttaagtctgcggcaccagataaggcgccggcaaaaaatggatcaagcttcaatcagcttcttggtattaaaggagctgcccaagaatc |
279 |
Q |
| |
|
||||||||| |||| |||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25507035 |
agcagttaaatctgaggcaccggataaggcgcctgcgaaaaatggatcaagcttcaatcagcttcttggtattaaaggagctgcccaagaatc |
25507127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 187 - 279
Target Start/End: Complemental strand, 25558763 - 25558671
Alignment:
| Q |
187 |
agcagttaagtctgcggcaccagataaggcgccggcaaaaaatggatcaagcttcaatcagcttcttggtattaaaggagctgcccaagaatc |
279 |
Q |
| |
|
||||||||| |||| |||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25558763 |
agcagttaaatctgaggcaccggataaggcgcctgcgaaaaatggatcaagcttcaatcagcttcttggtattaaaggagctgcccaagaatc |
25558671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 26 - 90
Target Start/End: Original strand, 25506878 - 25506942
Alignment:
| Q |
26 |
tgtttatgtggacattgcagagagaagattaactattagagcagctgaaactgatgcaaatgaag |
90 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25506878 |
tgtttatgttggcattgcagagagaagattaactattagagcagctgaaactgatgcaaatgaag |
25506942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University