View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19399_low_28 (Length: 279)
Name: NF19399_low_28
Description: NF19399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19399_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 18 - 160
Target Start/End: Complemental strand, 39918494 - 39918352
Alignment:
| Q |
18 |
aagaatactcagcaccattttcacgaaaccattgttccattttctctaccagttttagccctattcccattcttctatgatttggagaaactcttaagcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918494 |
aagaatactcagcaccattttcacgaaaccattgttccattttctctaccagttttagccctattcccattcttctatgatttggagaaactcttaagcc |
39918395 |
T |
|
| Q |
118 |
taaaacgtaggctagttttgtgaaaacagggacatgattggaa |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918394 |
taaaacgtaggctagttttgtgaaaacagggacatgattggaa |
39918352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 209 - 271
Target Start/End: Complemental strand, 39918303 - 39918241
Alignment:
| Q |
209 |
ccgcatgtaacggttttgatacaacctcgtatcattccgactgtctcattgcctatctctgct |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39918303 |
ccgcatgtaacggttttgatacaacctcgtatcattccgactgtctcattgcctatctctgct |
39918241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University