View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19399_low_36 (Length: 251)
Name: NF19399_low_36
Description: NF19399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19399_low_36 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 12 - 251
Target Start/End: Complemental strand, 3453536 - 3453297
Alignment:
| Q |
12 |
ataatatcgaagatgacacaactgagggattcttccaattccaaccacgaactttgggctcgcttttcacttctaatggatccaccaggccacacagaat |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3453536 |
ataataacgaagatgacacaactgagggattcttccaattccaaccacgaactttgggctcgcttttcacttctaatggatccaccaggccacacagaat |
3453437 |
T |
|
| Q |
112 |
ctcacacaagttcaatggttttccggacaacgattcttactcaaaccattctagtaacatcatttcaaatggaacaaattcaattgaggatgcatcttct |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3453436 |
ctcacacaagttcaatggttttccggacaacgattcttactcaaaccattctagtaacatcatttcaaatggaacaaattcaattgaggatgcatcttct |
3453337 |
T |
|
| Q |
212 |
gttattgttgatgcttcagatatgtcagaatcaacaaatt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3453336 |
gttattgttgatgcttcagatatgtcagaatcaacaaatt |
3453297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University