View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19399_low_42 (Length: 239)
Name: NF19399_low_42
Description: NF19399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19399_low_42 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 44194058 - 44193933
Alignment:
| Q |
1 |
ttggtagttgccgttaccgtttcccccgattttattatagagtgaaaaaagatcacgaggaaatgccgtcacagccgcaacaaaacaccgttactaccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
44194058 |
ttggtagttgccgttaccgtttcccccgattttattatagagtgaaaaaagatcacgaggaaatgctgtcacagccgcaacgaaacaccgttactaccaa |
44193959 |
T |
 |
| Q |
101 |
aagaaaagaaaacgttgttcatgaca |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
44193958 |
aagaaaagaaaacgttgttcatgaca |
44193933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 149 - 182
Target Start/End: Complemental strand, 44307907 - 44307874
Alignment:
| Q |
149 |
tttaattgagatggatgaaaatcacatttttagt |
182 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
44307907 |
tttaattgggatggatgaaaatcacatttttagt |
44307874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 143 - 187
Target Start/End: Original strand, 33049111 - 33049155
Alignment:
| Q |
143 |
ttattttttaattgagatggatgaaaatcacatttttagtgcata |
187 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33049111 |
ttatttttcaattgagatggatgaaaatcacatttttagtacata |
33049155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 180
Target Start/End: Original strand, 31742874 - 31742910
Alignment:
| Q |
144 |
tattttttaattgagatggatgaaaatcacattttta |
180 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31742874 |
tatttttcaattgagatggatgaaaatcacattttta |
31742910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 146 - 187
Target Start/End: Complemental strand, 14867424 - 14867383
Alignment:
| Q |
146 |
ttttttaattgagatggatgaaaatcacatttttagtgcata |
187 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14867424 |
tttttcaattgagatggatgaaaatcacatttttagtacata |
14867383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 143 - 180
Target Start/End: Complemental strand, 14355054 - 14355017
Alignment:
| Q |
143 |
ttattttttaattgagatggatgaaaatcacattttta |
180 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14355054 |
ttatttttcaattgagatggatgaaaatcacattttta |
14355017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 144 - 182
Target Start/End: Original strand, 46475577 - 46475615
Alignment:
| Q |
144 |
tattttttaattgagatggatgaaaatcacatttttagt |
182 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
46475577 |
tatttttcaattgatatggatgaaaatcacatttttagt |
46475615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 141 - 182
Target Start/End: Original strand, 53527054 - 53527095
Alignment:
| Q |
141 |
cgttattttttaattgagatggatgaaaatcacatttttagt |
182 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| ||||||||||| |
|
|
| T |
53527054 |
cgttatttttcaattgaggtggatgaaaatgacatttttagt |
53527095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University