View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1939_high_4 (Length: 271)
Name: NF1939_high_4
Description: NF1939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1939_high_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 16 - 153
Target Start/End: Complemental strand, 55063098 - 55062960
Alignment:
| Q |
16 |
tttcttttatatttaggttgataaattgatgagaaattttatttggttggaatgtcaatgtcaagaagttagtgactgttgtttgcaatagagtttgctt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
55063098 |
tttcttttatatttaggttgataaattgatgagaaattttatttggttggaatgtcaatgtcaataagttagtgactgttgtttgacatagagtttgctt |
55062999 |
T |
|
| Q |
116 |
acg-ttgtttaccatatcatatctactactactaactgg |
153 |
Q |
| |
|
||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
55062998 |
acgtttgtttaccatatcatatctactacagctaactgg |
55062960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 143 - 256
Target Start/End: Complemental strand, 55062182 - 55062079
Alignment:
| Q |
143 |
ctactaactggtatggtcttaaaggtagtagtttattattgttgatagtttaaaatggtagtttattggtggggtgcggtggtaacttcgtacactttta |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
55062182 |
ctactaactggtatggtcttaaaggtagtagtttattattgttgatagtttaaaatggtaggttatt----------ggtggtaacttcgtacactttta |
55062093 |
T |
|
| Q |
243 |
gattgcccattgat |
256 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
55062092 |
gattgaccattgat |
55062079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University