View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19400_high_12 (Length: 370)
Name: NF19400_high_12
Description: NF19400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19400_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 7e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 216 - 346
Target Start/End: Complemental strand, 22078499 - 22078369
Alignment:
| Q |
216 |
gatgagggaacacctatgattgatctagtttgttcttctaaaaacatttcctgcggtttttcctacagattttcctatgtcatttgctgcgaaaatacct |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22078499 |
gatgagggaacacctatgattgatctagtttgttcttctaaaaacatttcctgcggtttttcctacagattttcctatgtcatttgctgcgaaaatacct |
22078400 |
T |
 |
| Q |
316 |
gcggatatgattcagttaatgtgttcacggg |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
22078399 |
gcggatatgattcagttaatgtgttcacggg |
22078369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 9 - 95
Target Start/End: Complemental strand, 22078710 - 22078623
Alignment:
| Q |
9 |
gaataatata--atcctcctcatacccgagtaatacgagagatctcgatctcaatgtaagattagccctcaaactacaagcggatcgaa |
95 |
Q |
| |
|
|||||||||| |||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22078710 |
gaataatataccatccacctcatacccaa-taatacgagagatctcgatctcaatgtaagattagccctcaaactacaagcggatcgaa |
22078623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University