View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19400_high_26 (Length: 227)
Name: NF19400_high_26
Description: NF19400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19400_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 107
Target Start/End: Complemental strand, 40261066 - 40260960
Alignment:
| Q |
1 |
aaaagtgaaacaatctttcatctaccattggactcaaaagcagtcattacatcaagcatttcttgttgtcatactgaattggataatgttaccttgaagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40261066 |
aaaagtgaaacaatctttcatctaccattggactcaaaagcagtcattacatcaagcatttcttgttgtcatactgaattggataatgttaccttgaagg |
40260967 |
T |
 |
| Q |
101 |
ttttagg |
107 |
Q |
| |
|
||||||| |
|
|
| T |
40260966 |
ttttagg |
40260960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 158 - 218
Target Start/End: Complemental strand, 40260909 - 40260849
Alignment:
| Q |
158 |
caagtgttggtaactcaggtagtcataaatataatgcatatgagaagtatttctctgtgag |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
40260909 |
caagtgttggtaactcaggtagttataaatatgatgcatattagaagtatttctctgtgag |
40260849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University