View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19400_low_14 (Length: 364)
Name: NF19400_low_14
Description: NF19400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19400_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 10 - 201
Target Start/End: Complemental strand, 1006219 - 1006030
Alignment:
| Q |
10 |
tcatcattttgttgaattttggtttcattaataagcgtagatttatttattgctcttctaacctggatattcttgtttgttgattgtgttatgaacatct |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1006219 |
tcattattttgttgaattttggtttcattaataagcgtagatttatttattgctcttctaacct-gatattcttgtttgttgattgtgttatgaacatct |
1006121 |
T |
 |
| Q |
110 |
tcannnnnnnnnnaacttgatagtttggacttattgggcgtgattgatcttgatggagacgatacatctaccactagaagacccaaaattga |
201 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1006120 |
tca-tttttttttaacttgatagtttggacttattgggcgtgattgatcttgatggagacgatacatctaccactagaagacccaaaattga |
1006030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 266 - 346
Target Start/End: Complemental strand, 1005965 - 1005884
Alignment:
| Q |
266 |
aggatgcatgaatcttcagcgatttatttcagagaattgatttaac-tttgtttttgcactttttatctattaaatttgcat |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1005965 |
aggatgcatgaatcttcagcgatttatttcagagaattgatttaacttttgtttttgcactttttatctattaaatttgcat |
1005884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University