View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19400_low_18 (Length: 328)
Name: NF19400_low_18
Description: NF19400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19400_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 10 - 309
Target Start/End: Original strand, 16163631 - 16163930
Alignment:
| Q |
10 |
attatactctagcaaacaacggttcaactaaaccggttcttgatgttcatgttgaaccggttttatcaatggatttttacgatgaatttcgatctatagc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16163631 |
attatactctagcaaacaacggttcaactaaaccggttcttgatgttcatgttgaacctgttttatcaatggatttttacgatgaatttcgatctatagc |
16163730 |
T |
 |
| Q |
110 |
aaggtgcccattacttcaaacgaattcaactatctccggtggggttaaagttgttgacttgcggcgttccggcgatgtgggtcatcggagttttggtgtt |
209 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16163731 |
aaggtgcccatttcttcaaacgaattcaactatctccggtggggttaaagttgttgacttgcggcgttccggcgatgtgggtcatcggagttttggtgtt |
16163830 |
T |
 |
| Q |
210 |
ttgaagaatcaaacacctcaatcttgggatagagtagcgtatgaagctagtttagatggtgatactgttgttgtttttgtgaaagggttgaatcttaggc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16163831 |
ttgaagaatcaaacacctcaatcttgggatagagtagcgtatgaagctagtttagatggtgatactgttgttgtttttgtgaaagggttgaatcttaggc |
16163930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University