View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19400_low_5 (Length: 438)
Name: NF19400_low_5
Description: NF19400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19400_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 3e-64; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 243 - 367
Target Start/End: Original strand, 2551156 - 2551280
Alignment:
| Q |
243 |
cagatgttcatgtttcgaagaatgccactattgcggagcttaaggatgctgtggaaggtgtttttagttacatgcctcagcatggtcctgccaaaatttc |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2551156 |
cagatgttcatgtttcgaagaatgccactattgcggagcttaaggatgctgtggaaggtgtttttagttacatgcctcagcatggtcctgccaaaatttc |
2551255 |
T |
|
| Q |
343 |
atggtatttcttcactcactatgtc |
367 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2551256 |
atggtatttcttcactcactatgtc |
2551280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 76 - 156
Target Start/End: Original strand, 2549840 - 2549920
Alignment:
| Q |
76 |
ttctaccaagagtttgctctacgataagcttccttcggaaccgttaaggctttctgttctcaaattagacggaacttcttt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2549840 |
ttctaccaagagtttgctctacgataagcttccttcggaaccgttaaggctttctgttctcaaattagacggaacttcttt |
2549920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 3 - 40
Target Start/End: Original strand, 2549770 - 2549807
Alignment:
| Q |
3 |
ttccgaacatgaagaagaaaactacgctattttcatca |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2549770 |
ttccgaacatgaagaagaaaactacgctattttcatca |
2549807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University