View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19400_low_8 (Length: 416)
Name: NF19400_low_8
Description: NF19400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19400_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 14 - 334
Target Start/End: Complemental strand, 3929947 - 3929628
Alignment:
| Q |
14 |
aggcgaaagggcttagaagatttgattacattgcatggattcacagttattttctttagatgtttagatgatagagttttannnnnnnngttaggatttg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3929947 |
aggcgaaagggcttagaagatttgattacattgcatggattcacagttattttctttagatgtttagatgatagagttttattttgtt-gttaggatttg |
3929849 |
T |
 |
| Q |
114 |
aatctaatttctcttggaaaaagtgaatcttgaattttgaattgatctgttgaatctatgatacttaatcaaattgattgcatttaattgttcaaactaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3929848 |
aatctaatttctcttggaaaaagtgaatcttgaattttgaattgatctgttgaatctatgatacttaatcaaattgattgcatttaattgttcaaactaa |
3929749 |
T |
 |
| Q |
214 |
ttttcaattttgtttaacttgatttgatgaaaatttgatcatagtaactaatttgttgctttttagctttgaagttgggaaattttgcttcaattttaat |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3929748 |
ttttcaattttgtttaacttgatttgatgaaaattcgatcatagtaactaatttgttgctttttagctttgacgttgggaaattttgcttcaattttaat |
3929649 |
T |
 |
| Q |
314 |
atcgaagttgtctatggatat |
334 |
Q |
| |
|
|| |||||||||||||||||| |
|
|
| T |
3929648 |
attgaagttgtctatggatat |
3929628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University