View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19401_high_36 (Length: 215)
Name: NF19401_high_36
Description: NF19401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19401_high_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 14 - 200
Target Start/End: Original strand, 5905644 - 5905828
Alignment:
| Q |
14 |
ataattctacagtcttctgttattcatactccatatactcagatgatccatttgcttacgtttccgaccacccatcgtatttactttctccttcggtatt |
113 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || ||||||||| |||||||||||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
5905644 |
ataattctacagtcttctgctattcatactccata--ctaagatgatccttttgcttacgtttccgactacccttcttatttactttctccttcggtatt |
5905741 |
T |
|
| Q |
114 |
tcttaaaactgctctgttaaacactgatgtgcaatatttttcacttcatcaattagccctttattataagaatccaacccttctgtt |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5905742 |
tcttaaaactgttctgttaaacactgatgtgcaatatttttcacttcatcaattagccctttattataagaatccaacccttttgtt |
5905828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University