View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19401_low_22 (Length: 297)
Name: NF19401_low_22
Description: NF19401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19401_low_22 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 14 - 297
Target Start/End: Original strand, 40213966 - 40214249
Alignment:
| Q |
14 |
agatatatatgctttctaaggtaatagttctagatattaaattagtgttggattggatgttttattttttcacaagcaaaaatgatttatcaatattcat |
113 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40213966 |
agatatatatgctttctaaagtaatagttctagatattaaattagtgttggattggatgttttattttttcacaagcaaaaacgatttatcaatattcat |
40214065 |
T |
 |
| Q |
114 |
ttatgctaattctcctgcactgaccctttattatattatttgtatgaatattatttatttctgccatgcatgcagggaacaaattaatgttgaaccggac |
213 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40214066 |
ttatgctaattctcctgcactgaacctttattatattatttctatgaatattatttatttctgccatgcatgcagggaacaaattaatgttgaaccggac |
40214165 |
T |
 |
| Q |
214 |
ccgcattgagtaagactccattgcttgaattcggtggccatggtgtactgtcttagcttcttcttgtaaaaatgaccttatcct |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40214166 |
ccgcattgagtaagactccattgcttgaattcggtggccatggtgtactgtcttagcttcttcttgtaaaaatgaccttatcct |
40214249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University