View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19401_low_27 (Length: 266)
Name: NF19401_low_27
Description: NF19401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19401_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 15 - 250
Target Start/End: Original strand, 20013703 - 20013934
Alignment:
| Q |
15 |
tcataaagggagataaagcttcacaaacatatattttaccaaaggtcataaattactttgatcacaatctcttttttgttggaaaaagtactttaataag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20013703 |
tcataaagggagataaagcttcacaaacatatattttaccaaaggtcataaattactttgatcacaatctcttttttgttggaaaaagtactttaataag |
20013802 |
T |
 |
| Q |
115 |
taagtaattcttattttcattcacaagaactaaatatctaaaaatcattgaaaaggaaatttgaagctgaggcaggttagtttctcttgccccaattcta |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
20013803 |
----taattcttattttcattcacaagaactgaatatctaaaaatcgttgaaaaggaaatttgaagctgaggcaggttagtttctcttgccccaatccta |
20013898 |
T |
 |
| Q |
215 |
cgtttgttaacacaaaatggcaatgcacgaggaaat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
20013899 |
cgtttgttaacacaaaatggcaatgcacgaggaaat |
20013934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University