View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19401_low_30 (Length: 250)
Name: NF19401_low_30
Description: NF19401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19401_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 90 - 233
Target Start/End: Original strand, 8132245 - 8132388
Alignment:
| Q |
90 |
atgtcatctttaaaaacttatttattactatttactagtatcggtaaaattttgtataatataaaccaagtatcacccgtatgcaactacaaatacaagt |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
8132245 |
atgtcatctttaaaaacttatttattactatttactagtatcagttaaattttgtatgatataaaccaagtatcatccgtgtgcaactacaaatacaagt |
8132344 |
T |
|
| Q |
190 |
acctatttcactgtatccacaaactcaccaaattctcaagttac |
233 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
8132345 |
acctattttactgtatccacaaacttaccaaattctcaagttac |
8132388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University