View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19401_low_32 (Length: 246)
Name: NF19401_low_32
Description: NF19401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19401_low_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 229
Target Start/End: Original strand, 2530538 - 2530756
Alignment:
| Q |
11 |
agaatatcgcaaagagtgctaagaaggaagctcctgtcaagaatggtgtttctgctaagaaggaattagctatagttactaagaatgtaagtggaaaagt |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2530538 |
agaaaatcgcaaagagtgctaagaaggaagctcctgtcaagaatggtggttctgctaagaaggaattagctatagttactaagaatgtaagtggaaaagt |
2530637 |
T |
 |
| Q |
111 |
ggaaagtggtgttggtaagagtttcattttgagcgaactggttaaatttgatgaggctgcgggtatagctgtgcttgataaggatgctgcagaaagcggt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2530638 |
ggaaagtggtgttggtaagagtttcattttgagcgaactggttaaatttgatgaggctgcgggtatagctgtgctcgataaggatgctgcagaaagcggt |
2530737 |
T |
 |
| Q |
211 |
ttggaattgatgggggagt |
229 |
Q |
| |
|
|||||||||||| |||||| |
|
|
| T |
2530738 |
ttggaattgatgagggagt |
2530756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University