View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19401_low_34 (Length: 232)
Name: NF19401_low_34
Description: NF19401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19401_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 79 - 216
Target Start/End: Original strand, 26015714 - 26015851
Alignment:
| Q |
79 |
tatatagagatggaagcatgcaacaaagttatgattgtggggatgttgtttgccattgctaatgctatgtttgctaatggtgaattgacggtatgtaatt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26015714 |
tatatagagatggaagcatgcaacaaagttatgattgtggggatgttgtttgccattgctaatgccatgtttgctaatggtgaattgacggtatgtaatt |
26015813 |
T |
 |
| Q |
179 |
taacaaggaaagaacggatggcatgtgagtcgtatatt |
216 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26015814 |
taacaagaaaagaacggatggcatgtgagtcgtatatt |
26015851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 18 - 79
Target Start/End: Original strand, 26015573 - 26015634
Alignment:
| Q |
18 |
acaattggccattaaacaccactaaattaaattttattgactattgcgacaatgttcaattt |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26015573 |
acaattggccattaaacaccactaaattaaattttattgactattgcgacaatgttcaattt |
26015634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University