View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19401_low_4 (Length: 471)
Name: NF19401_low_4
Description: NF19401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19401_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 2e-74; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 18 - 163
Target Start/End: Complemental strand, 48403049 - 48402904
Alignment:
| Q |
18 |
agtataacatagaattgtgcaatgaatcgaaggaagtgacaacaagagagcaaatgttgaaattttttagtttaagaaagtatccgaaacaggtatcact |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48403049 |
agtataacatagaattgtgcaatgaatcgaaggaagtgacaacaagagagcaaatgttgaaattttttagtttaagaaagtatccgaaacaggtatcact |
48402950 |
T |
 |
| Q |
118 |
tgaacaaattcaatatcatatttgagagaatattactctttgtgaa |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48402949 |
tgaacaaattcaatatcatatttgagagaatatcactctttgtgaa |
48402904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 357 - 460
Target Start/End: Complemental strand, 48402763 - 48402660
Alignment:
| Q |
357 |
ttctagtggattataattgatcgcaaaaacggtggtttggtttctgaccatgtcatacggacatcatcttgaatgcctagtctaccataacgatctgcgt |
456 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48402763 |
ttctagtggattataattgatcgcaaaaacggtgttttggtttctgaccatgtcatacggacatcatcttgaatgcctagtctaccataacgatctgcgt |
48402664 |
T |
 |
| Q |
457 |
ctgt |
460 |
Q |
| |
|
|||| |
|
|
| T |
48402663 |
ctgt |
48402660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 207 - 279
Target Start/End: Complemental strand, 48402913 - 48402841
Alignment:
| Q |
207 |
tctttgtgaaatatcttaaagggccaaacgtattttcctgtgttattttctgtgaccgtctttaaaatctcac |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
48402913 |
tctttgtgaaatatcttaaagggccaaacgtattttcctgtgttattttctgtgaccatctctaaaatctcac |
48402841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University