View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19402_high_12 (Length: 230)
Name: NF19402_high_12
Description: NF19402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19402_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 35 - 215
Target Start/End: Original strand, 8577387 - 8577563
Alignment:
| Q |
35 |
gtttgaggaaacacaaaaatgtgatggttagagg--ctgagagaattattcaccaaacaaaaaggatgttgagaggattaaaggagatgaacatgttaat |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
8577387 |
gtttgaggaaacacaaaaatgtgatggttagagagactgagagaattattcaccaaacaaaaagtatgttgagaggattgaaggagatgcacatgt---- |
8577482 |
T |
|
| Q |
133 |
gttaatgttaatggtgaggttatgaaaggaatcatattatatggattgaagaaaaagatggtagctggaatgatctctccaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8577483 |
--taatgttaatggtgaggttatgaaaggaatcatattatatggattgaagaaaatgatggtagctggaatgatctctccaaa |
8577563 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 89
Target Start/End: Complemental strand, 8597544 - 8597490
Alignment:
| Q |
35 |
gtttgaggaaacacaaaaatgtgatggttagaggctgagagaattattcaccaaa |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8597544 |
gtttgaggaaacacaaaaatgtgatggttagagactgagagaattattcaccaaa |
8597490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University