View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19402_high_2 (Length: 517)
Name: NF19402_high_2
Description: NF19402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19402_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 286; Significance: 1e-160; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 173 - 483
Target Start/End: Original strand, 27693609 - 27693919
Alignment:
| Q |
173 |
gtcaacgtcaacgcttttcccccaaattttcaannnnnnnacatgatttcgaattagggtttgggatttcacgtcaatggaagggaacggagcatcatct |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27693609 |
gtcaacgtcaacgcttttcccccaaattttcaatttttttacatgatttcgaattagggtttgggatttcacgtcaatggaagggaacggagcatcatct |
27693708 |
T |
|
| Q |
273 |
tcatcatcgagaagatatggattcccgtcggctgcaagcataattcaagcaccgttatcagcgctgttggaatattccggtattcttccggcgaggtcaa |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27693709 |
tcatcatcgagaagatatggattcccgtcggctgcaagcataattcaagcaccgttatcagcgctgttggaatattccggtattcttccggcgaggtcaa |
27693808 |
T |
|
| Q |
373 |
accagcaacatcaaccaattcccgattctgcccctaacgatggtgaggtttcaattaggatcattgggtctaacgagcaagataatcatcgggatgaaca |
472 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27693809 |
accagcaacatcaaccaattcccgattctgcccctaacgatggtgaggtttcaattaggatcattgggtctaacgagcaagataatcatcgagatgaaca |
27693908 |
T |
|
| Q |
473 |
gggtagtccac |
483 |
Q |
| |
|
||||||||||| |
|
|
| T |
27693909 |
gggtagtccac |
27693919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 23 - 92
Target Start/End: Original strand, 27693459 - 27693528
Alignment:
| Q |
23 |
ggcgccattctccctcacaacacaccagagagcgagcgagcgagaatcacaacgaaaaatcacacaaacc |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27693459 |
ggcgccattctccctcacaacacaccagagagcgagcgagcgagaatcacaacgaaaaatcacacaaacc |
27693528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University