View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19402_high_9 (Length: 256)
Name: NF19402_high_9
Description: NF19402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19402_high_9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 6 - 256
Target Start/End: Original strand, 10461693 - 10461943
Alignment:
| Q |
6 |
caaaggggaattgtcaaacaatgattaaataatatgaaaatgcagcatgataagcaaaccttattaccttaatgttataaaaaactttaccattggagat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461693 |
caaaggggaattgtcaaacaatgattaaataatatgaaaatgcagcatgataagcaaaccttattaccttaatgttataaaaaactttaccattggagat |
10461792 |
T |
|
| Q |
106 |
aatcggaaagttgctgtagcttccgcgctgaaacctgttattccaccagcagggaacaagtatgtcaatagcgtcggggatgttgggtccaaacatatcc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461793 |
aatcggaaagttgctgtagcttccgcgctgaaacctgttattccaccagcagggaacaagtatgtcaatagcgtcggggatgttgggtccaaacatatcc |
10461892 |
T |
|
| Q |
206 |
ctgagcaccgccatagcttctctcaaagtctcttcattggtctgagcttcc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10461893 |
ctgagcaccgccatagcttctctcaaagtctcttcattggtctgagcttcc |
10461943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University