View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19402_low_10 (Length: 246)
Name: NF19402_low_10
Description: NF19402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19402_low_10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 246
Target Start/End: Complemental strand, 10462224 - 10461995
Alignment:
| Q |
17 |
aatacacaaaccctgttcaataatgcattgactttggatctaaacttatgtggtgtatatgaaaataattgaattaagaatcaaataagaacattggtga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10462224 |
aatacacaaaccctgttcaataatgcattgactttggatctaaacttatgtggtgtatatgaaaataattgaattaagaatcaaataagaacattggtga |
10462125 |
T |
 |
| Q |
117 |
ttgtagtccttttacttattcatccaacacagaaaacataatattgtagttgtctaggatctcttgcttactcatccaaatcacttatctgctgatttgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10462124 |
ttgtagtccttttacttattcatccaacacagaaaacataatattgtagttgtctaggatctcttgcttactcatccaaatcacttatctgctgatttgt |
10462025 |
T |
 |
| Q |
217 |
ttgttaccagcacatggataatgcatatcc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10462024 |
ttgttaccagcacatggataatgcatatcc |
10461995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University