View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19402_low_12 (Length: 230)

Name: NF19402_low_12
Description: NF19402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19402_low_12
NF19402_low_12
[»] chr3 (2 HSPs)
chr3 (35-215)||(8577387-8577563)
chr3 (35-89)||(8597490-8597544)


Alignment Details
Target: chr3 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 35 - 215
Target Start/End: Original strand, 8577387 - 8577563
Alignment:
35 gtttgaggaaacacaaaaatgtgatggttagagg--ctgagagaattattcaccaaacaaaaaggatgttgagaggattaaaggagatgaacatgttaat 132  Q
    |||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||        
8577387 gtttgaggaaacacaaaaatgtgatggttagagagactgagagaattattcaccaaacaaaaagtatgttgagaggattgaaggagatgcacatgt---- 8577482  T
133 gttaatgttaatggtgaggttatgaaaggaatcatattatatggattgaagaaaaagatggtagctggaatgatctctccaaa 215  Q
      ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
8577483 --taatgttaatggtgaggttatgaaaggaatcatattatatggattgaagaaaatgatggtagctggaatgatctctccaaa 8577563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 89
Target Start/End: Complemental strand, 8597544 - 8597490
Alignment:
35 gtttgaggaaacacaaaaatgtgatggttagaggctgagagaattattcaccaaa 89  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
8597544 gtttgaggaaacacaaaaatgtgatggttagagactgagagaattattcaccaaa 8597490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University