View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19402_low_7 (Length: 274)
Name: NF19402_low_7
Description: NF19402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19402_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 18 - 267
Target Start/End: Complemental strand, 8185561 - 8185315
Alignment:
| Q |
18 |
atatccgtctctatgggtta--ctgtagcagaatccacattccatgcatgtttgcgtgcggacaatacctgatttnnnnnnnnnnnnnnnnntactcacc |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8185561 |
atatccgtctctatgggttatactgtagcagaatccacattccatgcatgtttgcgtgcggacaatacctgatttaaaaaaaaaaaa-----tactcacc |
8185467 |
T |
 |
| Q |
116 |
caattccatgcatgtttgagtggcattggttgagccaagtatgttttggtgctgtgtataatataaatcatctatttgaaatttaggtatggtcaaaata |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8185466 |
caattccatgcatgtttgagtggcattggttgagccaagtatgttttggtgctgcgtataatataaatcatctatttgaaatttaggtatggtcaaaata |
8185367 |
T |
 |
| Q |
216 |
atactaccaaagtgtacggagtgatttcttggcccaaaagttactgacttgt |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8185366 |
atactaccaaagtgtacggagtgatttcttggcccaaaagttactgacttgt |
8185315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University