View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19402_low_8 (Length: 265)
Name: NF19402_low_8
Description: NF19402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19402_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 8185323 - 8185096
Alignment:
| Q |
1 |
ctgacttgtgccttgcacatcatatattct-----ccttgaattttaacttaaaagctgtgaaattctcacatggttttgttcaatttgtagctatttct |
95 |
Q |
| |
|
||||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8185323 |
ctgacttgtaccctgcacatcatatattctattctccttgaattttaacttaaaagctgtgaaattctcaca-------gttcaatttgtagctatttct |
8185231 |
T |
|
| Q |
96 |
attcttagaaagtttttagtagtgaattggtctttgacccttttattcataaggaaattcaaaagtaaaggatcaactttcatttgtatacaacttcttt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8185230 |
attcttagaaagtttttagtagtgaattggtctttgacccttttattcataaggaaattcaaaagtaaaggatcaactttcatttgtatacaacttcttt |
8185131 |
T |
|
| Q |
196 |
tgacaaaacttatttaaaagatagtacaatacata |
230 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8185130 |
tgataaaacttatttaaaagatagtacaatacata |
8185096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 224 - 257
Target Start/End: Complemental strand, 8185091 - 8185058
Alignment:
| Q |
224 |
atacatataattatttcaatgtttttgtgatatt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8185091 |
atacatataattatttcaatgtttttgtgatatt |
8185058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University