View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19403_high_11 (Length: 532)
Name: NF19403_high_11
Description: NF19403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19403_high_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 191 - 459
Target Start/End: Original strand, 784223 - 784492
Alignment:
| Q |
191 |
ccttccgaatttcataatccgaaataggtttgaaaagtgggaaaagaaattcacttaaccttttgtatcttattaagattaagatggtgttttggctcat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
784223 |
ccttccgaatttcataatccgaaataggtttgcaaagtgggaaaagaaattcacttaaccttttgtatcgtattaagattaagatggtgttttggctcct |
784322 |
T |
|
| Q |
291 |
ctttttagtttttatttatgagagatacactttttgtcgtaagtatgatattgactctcctccatttag-ttttttatttatgagagagatagacatgtg |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
784323 |
ctttttagtttttatttatgagagatacactttttgtcgtaagtatgatattgactctcctccatttagtttttttatttatgagagagatagacatgtg |
784422 |
T |
|
| Q |
390 |
atatcttagtaattaagtggatcccacaaaaccatcacttatttatctctcttataaatagacattaaat |
459 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
784423 |
atatcttagtgattaagtggatcccacaaaactatcacttatttatctctcttataaatagacattaaat |
784492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 17 - 87
Target Start/End: Original strand, 784042 - 784112
Alignment:
| Q |
17 |
accaacatcattgatccaattggtagataactgaatttctaattgaaagaacatctgccaagatgtcaacc |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
784042 |
accaacatcattgatccaattggtagataactgaatttctaattgaaagaacatctgccaagatgtcaacc |
784112 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University