View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19403_high_32 (Length: 254)
Name: NF19403_high_32
Description: NF19403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19403_high_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 48593815 - 48594058
Alignment:
| Q |
1 |
ctataaatgtcaacggaggtacggagttatattatgtgatattagatattgagataactaaactaatcctacaattttatgactaaatattgaatatata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48593815 |
ctataaatgtcaacggaggtacggagttatattatgtgatactagatattgagataactaaactaatcctacaattttatgactaaatattgaatatata |
48593914 |
T |
 |
| Q |
101 |
gtggcaaggagttataggaattaggtaagggtaggaaatgttgtattatgtagagagaagcagtaacaggatatcgcctgcaatgcagggtgattgtttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48593915 |
gtggcaaggagttataggaattaggtaagggtaggaaatgttgtattatgtagagagaagctgtaacaggatatcgcctgcaatgcagggtaattgtttt |
48594014 |
T |
 |
| Q |
201 |
aattttctcatagttttgctatttgatcttcctttcatctcact |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48594015 |
aattttctcatagttttgctatttgatcttcctttcatttcact |
48594058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University