View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19403_high_39 (Length: 239)
Name: NF19403_high_39
Description: NF19403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19403_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 181 - 226
Target Start/End: Complemental strand, 10254527 - 10254482
Alignment:
| Q |
181 |
atggagggatagaagaagttgttggtggttgtttacttgttattat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10254527 |
atggagggatagaagaagttgttggtggttgtttacttgttattat |
10254482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 52
Target Start/End: Complemental strand, 10254698 - 10254659
Alignment:
| Q |
13 |
tgaatagtagtgctgggagtgacgatgtttgtcgtttttt |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10254698 |
tgaatagtagtgctgggagtgacgatgtttgtggtttttt |
10254659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University