View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19403_high_39 (Length: 239)

Name: NF19403_high_39
Description: NF19403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19403_high_39
NF19403_high_39
[»] chr5 (2 HSPs)
chr5 (181-226)||(10254482-10254527)
chr5 (13-52)||(10254659-10254698)


Alignment Details
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 181 - 226
Target Start/End: Complemental strand, 10254527 - 10254482
Alignment:
181 atggagggatagaagaagttgttggtggttgtttacttgttattat 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
10254527 atggagggatagaagaagttgttggtggttgtttacttgttattat 10254482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 13 - 52
Target Start/End: Complemental strand, 10254698 - 10254659
Alignment:
13 tgaatagtagtgctgggagtgacgatgtttgtcgtttttt 52  Q
    |||||||||||||||||||||||||||||||| |||||||    
10254698 tgaatagtagtgctgggagtgacgatgtttgtggtttttt 10254659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University