View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19403_high_40 (Length: 238)
Name: NF19403_high_40
Description: NF19403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19403_high_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 2043433 - 2043230
Alignment:
| Q |
19 |
agaaatggcattgttgctttaggacagtaacttttacaacatggtagggtgtggacgcaaacccttttccaccctttcacttgaatagtggtggaagggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2043433 |
agaaatggcattgttgctttaggacaataacttttacaacatggtagggtgtggacgcaaacccttttccaccctttcacttgaatagtggtggaagggt |
2043334 |
T |
 |
| Q |
119 |
gagtttgacacatgtcaaattctcctttttcatctattttttaggtcgaggtggtgaagaagaaatctctcatgcgagagtttctccataatgagcatgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2043333 |
gagtttgacacatgtcaaattctcctttttcatctattttttaggtcgagatggtgaagaagaaatctctcatgcgagagttttcccataatgagcatgt |
2043234 |
T |
 |
| Q |
219 |
ttat |
222 |
Q |
| |
|
|||| |
|
|
| T |
2043233 |
ttat |
2043230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University