View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19403_low_25 (Length: 346)
Name: NF19403_low_25
Description: NF19403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19403_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 24 - 174
Target Start/End: Complemental strand, 37134093 - 37133943
Alignment:
| Q |
24 |
gtatgctggtgatataataggaaaaagaataattggagcgttcaaatattattgttgtatttcaagctcaccaaagtgtactactgcttgcaacatcgcc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37134093 |
gtatgctggtgatataataggaaaaagaataattggagcgttcaaatattattgttgtatttcaagctcaccaaagtgtactactgcttgcaacatcgcc |
37133994 |
T |
 |
| Q |
124 |
gatacaagcttgctaatgggtagttgctaatgtgaatgatgtgattgtcac |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37133993 |
gatacaagcttgctaatgggtagttgctaatgtgaatgatgtgattgtcac |
37133943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 228 - 330
Target Start/End: Complemental strand, 37133697 - 37133595
Alignment:
| Q |
228 |
gcaatcacggctctccatctaatgtaaaacctcataaaagaggttcaagtgtggatcatccnnnnnnnacatgctacaataggtaattaatctcatatag |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37133697 |
gcaatcacggctctccatctaatgtaaaacctcataaaagaggttcaagtgtggatcatccattttttacatgctacaataggtaattaatctcatatag |
37133598 |
T |
 |
| Q |
328 |
att |
330 |
Q |
| |
|
||| |
|
|
| T |
37133597 |
att |
37133595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University