View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19403_low_27 (Length: 322)
Name: NF19403_low_27
Description: NF19403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19403_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 132 - 231
Target Start/End: Complemental strand, 21380984 - 21380885
Alignment:
| Q |
132 |
tcaggtggtattttatctttattggatacatcagaggtggaggtgtggcatactagaagtttggagaatgctctgattattaatggtcggtttgttaaaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21380984 |
tcaggtggtattttatctttattggatacatcagaggtggaggtgtggcatactagaagtttggagaatgctctgattattaatggtcggtttgttaaaa |
21380885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 229 - 322
Target Start/End: Complemental strand, 21380137 - 21380044
Alignment:
| Q |
229 |
aaagattggtgtgttcattggcctaatataattcaaagagttttactatgcgatctctcatatcatttcgcccattttgttatcaatagatgag |
322 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
21380137 |
aaagattggtgtgttcagtggcctaatataattcaaagagttttactatgcgatctctcatatcatttcccctattttgttatcaatagatgag |
21380044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University