View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19403_low_30 (Length: 261)
Name: NF19403_low_30
Description: NF19403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19403_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 55 - 211
Target Start/End: Original strand, 14780749 - 14780905
Alignment:
| Q |
55 |
aaagattctatcctataattcaagattcttatcgtcttagtctctaatgtcatcttttcatccaagatagatgacatggcacatggtatgagattttggt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14780749 |
aaagattctatcctataattcaagattcttatcgtcttagtctctaatgtcatcttttcatccaagatagatgacatggcacatggtatgagattttggt |
14780848 |
T |
 |
| Q |
155 |
gtcacgtgactgacgatatcatggcaaatcagtgccacgtggaagcaaaatcacata |
211 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14780849 |
gtcatgtggctgacgatatcatggcaaatcagtgccacatggaagcaaaatcacata |
14780905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 210 - 243
Target Start/End: Original strand, 14781176 - 14781209
Alignment:
| Q |
210 |
tatgagatatcacctcagcatgccacatcatcta |
243 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
14781176 |
tatgagatatcacctcagcatgccatatcatcta |
14781209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University