View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19403_low_35 (Length: 249)
Name: NF19403_low_35
Description: NF19403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19403_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 46501271 - 46501169
Alignment:
| Q |
1 |
aaaagaatggtagtggagcctagcaaaggggaatcttcttctgctactctcttttttgaagtgggtaagaagctaacaagattctcttttacatgttgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46501271 |
aaaagaatggtagtggagcctagcaaaggggaatcttcttctgctactctcttttttgaagtgggtaagaagctaacaagattctcttttacatgttgaa |
46501172 |
T |
|
| Q |
101 |
cga |
103 |
Q |
| |
|
||| |
|
|
| T |
46501171 |
cga |
46501169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 152 - 236
Target Start/End: Complemental strand, 46501120 - 46501035
Alignment:
| Q |
152 |
aaagatgtagtttattgattggatcacgtataatt-agcttgattctttgctggttttacctacacaagcaagataaaacgatcat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46501120 |
aaagatgtagtttattgattggatcacgtataatttagcttgattctttgctggttttacctacacaagcaagataaaacgatcat |
46501035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University