View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19403_low_38 (Length: 239)
Name: NF19403_low_38
Description: NF19403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19403_low_38 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 40274921 - 40274701
Alignment:
| Q |
1 |
atttctgaatccaccagtttgtgacacttattaatttgacacaaacatataatattatataacgatttacgcaagagatagaggagaattgagtgaagga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40274921 |
atttctgaatccaccagtttgtgacacttattaatttcacacaaacatataatatg---taacgatttacgcaagagatagaggagaattgagtgaacga |
40274825 |
T |
|
| Q |
101 |
aattgaactcacacatgttgcagcatgcagaaatgatgtactgtatgagggaaagaaaattgtctcttaattagcttcaaaccaaagccaacaacaaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40274824 |
aattgaactcacacatgttgcagcatgcagaaatgatgtactgtatgagggaaagaaaattgtctcttaattagcttcaaaccaaagccaacaacaaagg |
40274725 |
T |
|
| Q |
201 |
gttggaggctcggagcagatagat |
224 |
Q |
| |
|
||| ||| ||| |||||||||||| |
|
|
| T |
40274724 |
gttagagcctcagagcagatagat |
40274701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 96 - 140
Target Start/End: Original strand, 40599147 - 40599191
Alignment:
| Q |
96 |
aaggaaattgaactcacacatgttgcagcatgcagaaatgatgta |
140 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
40599147 |
aaggaattggaactcacacatgttgcagcatgcataaaggatgta |
40599191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University