View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19403_low_43 (Length: 235)
Name: NF19403_low_43
Description: NF19403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19403_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 46501323 - 46501543
Alignment:
| Q |
1 |
cttaatttagagtcgcagaattggaactaagatattccttccttggaggcaaatattttattctatatggtgaatgtctcattttttagattagatattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46501323 |
cttaatttagagtcgcagaattggaactaagatattccttccttggaggcaaatattttattctatatggtgaatgtctcattttttagattagatattc |
46501422 |
T |
 |
| Q |
101 |
ctcctcttctcttcatgaatgcactcaaattcatgacaattatgcaacttttggactcnnnnnnnnnnnnnnnngttgcaagttggattgatactataaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46501423 |
ctcctcttctcttcatgaatgcactcaaattcatgacaattatgcaacttttggactcaaaagaaaagaaaaaagttgcaagttggattgatactataaa |
46501522 |
T |
 |
| Q |
201 |
cctatttgaatatgtgctttc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46501523 |
cctatttgaatatgtgctttc |
46501543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University