View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19404_high_1 (Length: 543)
Name: NF19404_high_1
Description: NF19404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19404_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 347; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 17 - 390
Target Start/End: Complemental strand, 7308300 - 7307924
Alignment:
| Q |
17 |
atgtttatggcaccggtagttcttaatgaggttaacactccctttgaaggtggtg---gctttctctcggaaagaattccgtctaaaattaatctagtta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7308300 |
atgtttatggcaccggtagttcttaatgaggttaacactccctttgaaggtggtgatggctttctctcggaaagaattccgtctaaaattaatctagtta |
7308201 |
T |
|
| Q |
114 |
atacagggaatcgaggagtcattccattaggtgattcaatggattgggttgtgtgtggggaacgaggaatctgcactacttttgttccttcattgcaatt |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7308200 |
atacagcgaatcgaggagtcattccattaggtgattcaatggattgggttgtgtgtggggaacgaggaatctgcactacttttgttccttcattgcaatt |
7308101 |
T |
|
| Q |
214 |
ttgtttcagttgtgtggtgtagagtgtttaattggaagggcaaattttttgaaaatggagataaggatccggtggaggtggtggatatcaagcttttatt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7308100 |
ttgtttcagttgtgtggtgtagagtgtttaattggaagggcaaattttttgaaaatggagataaggattcggtggaggtggtggatatcaagcttttatt |
7308001 |
T |
|
| Q |
314 |
gtagaaatggtggttgagtaaatcgaagttgtctcattgcctctattatgaatggtgttgggatccttgtatgtgta |
390 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7308000 |
gtagaaatggtgattgagtaaatcgaagttgtctcattgcctctgttatgaatggtgttgggatccttgtatgtgta |
7307924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 447 - 533
Target Start/End: Complemental strand, 7307867 - 7307781
Alignment:
| Q |
447 |
actctgtattgtttcgggtatttggttgcagcaggttctgtattgtgtttctaccaggttcttttttctttctttctgggatctgtg |
533 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
7307867 |
actctgtattgtttcgggtatttggttgcagcaggttctgtattgtgtttctaccaggttcttttttcattctttctgggatctgtg |
7307781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University