View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19404_low_10 (Length: 229)
Name: NF19404_low_10
Description: NF19404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19404_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 34008050 - 34008261
Alignment:
| Q |
1 |
tattgtttttctttttagtaattagaagtggcatttcttcttgtttacacagttgtgtttgatttaattgatggatgaaatgccaggtttgttgtagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
34008050 |
tattgtttttctttttagtaattagaagtggcatttcttcttgtttacacagttgtgtttgatttaattgatggatgaaatgccaggtatgttgtagaga |
34008149 |
T |
 |
| Q |
101 |
cggtgtgagttccaataacttatatatgcactcttcttattaattaaatcctttgtttaaattatgcagtttatcacttttcaagctcaagctaactagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34008150 |
cggtgtgagttccaataacttatatatgtactcttcttattaattaaatcctttgtttaaattatgcagtttatcacttttcaagctcaaactaactagt |
34008249 |
T |
 |
| Q |
201 |
agtaactgtgat |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34008250 |
agtaactgtgat |
34008261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University