View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19404_low_5 (Length: 385)
Name: NF19404_low_5
Description: NF19404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19404_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 19 - 380
Target Start/End: Original strand, 35484795 - 35485153
Alignment:
| Q |
19 |
gtataaggtgatacctacgactcaatattatttattataccggttcaaagcccccatggccagccctcaacaattctgatgactgatgagcccccaaaac |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||||||||| | ||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
35484795 |
gtataaggtgatacctccgactcaatattatt----ataccggttcaaagcccctaaggccagccctcaataattctgatgactgacgagcccccaaaac |
35484890 |
T |
|
| Q |
119 |
aaggtgagccccgagattttggtttgcacatgcgagatatagctttatttgtatttgtttctctcacgtatagannnnnnnn-actattttgagtcgacg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| | ||||||||| |||| |
|
|
| T |
35484891 |
aaggtgagccccgagattttggtttgcacatgcgagttatagctttagttgtatttgtttctctcacgtatagatttttttttagtattttgaggtgacg |
35484990 |
T |
|
| Q |
218 |
tgatttctgcaaccatgctccaattatctcgtgtcagtttgaagctcccaagcatgagacttgaaagggcgaattcacgccttttagccaacatttgctt |
317 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35484991 |
tgatttctacaatcatgctccaattatctcgtgtcaatttgaagctcccaagcatgagatttgaaagggcgaattcacaccttttagccaacatttgctt |
35485090 |
T |
|
| Q |
318 |
ttcggtttctgattgacggttagatgttatcgtatctcgtttaagcacgtgttttcttctcag |
380 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
35485091 |
ttcggtttctgattgacggctagatgttatcgtatctcgtttaagcacgtgctttcttttcag |
35485153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University